EpiDyne Remodeling Assay Substrate DNA ST601-GATC0 Description: EpiDyne Remodeling Assay Substrate DNA ST601-GATC0 is a 217 base-pair double-stranded DNA fragment. This sequence includes the Lowary 601 nucleosome positioning sequence (see 18-0005) as well as a 3' acceptor sequence to accomodate the histone octamer subsequent to remodeling.
|
EpiDyne Remodeling Assay Substrate DNA ST601-GATC0 Formulation: 50 µg lyophilyzed ST601-GATC0 sequence DNA.
|
| EpiDyne Remodeling Assay Substrate DNA ST601-GATC0 Storage and Stability: Stable for 2 years at -20°C from date of receipt. After resuspending, aliquots should be stored at -80°C.
|
EpiDyne Remodeling Assay Substrate DNA ST601-GATC0 Application Notes: EpiDyne Remodeling Assay Substrate DNA ST601-GATC0 is useful as a negative control for restriction enzyme accessibility nucleosome remodeling assays using the EpiDyne Remodeling Assay Substrate. No restriction enzyme site is present.
DNA Sequence: GAATTCATCAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAA
ACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCAC
GTGTCAGATATATACATCGATGATGATGGATAGATGGATGATGGATGGATGGATGATGATGGATG
AATAGATGGATGGATGAAGCTT
|
| References:
Lowary PT and J Widom (1998). J Mol Biol 276: 19-42. Link
|
| View technical datasheet for this product.  |
