Account Navigation

Account Navigation

Currency - All prices are in AUD

Currency - All prices are in AUD
EpiCypher

EpiDyne Remodeling Assay Substrate DNA ST601-GATC1

Cat. No.: 18-4101
List Price: $99.00
Quantity:

Product Description

EpiDyne Remodeling Assay Substrate DNA ST601-GATC1 Description: EpiDyne Remodeling Assay Substrate DNA ST601-GATC1 is a 217 base-pair double-stranded DNA fragment. This sequence includes the Lowary 601 nucleosome positioning sequence (see 18-0005) as well as a 3' acceptor sequence to accomodate the histone octamer subsequent to remodeling. ST601-GATC1 DNA has a restriction enzyme site embedded in the 601 sequence that is accessible after nucleosome remodeling.
EpiDyne Remodeling Assay Substrate DNA ST601-GATC1 Formulation: 50 µg lyophilyzed ST601-GATC1 sequence DNA.

EpiDyne Remodeling Assay Substrate DNA ST601-GATC1 Storage and Stability: Stable for 2 years at -20°C from date of receipt. After resuspending, aliquots should be stored at -80°C.

EpiDyne Remodeling Assay Substrate DNA ST601-GATC1 Application Notes: EpiDyne Remodeling Assay Substrate DNA ST601-GATC0 is useful as a positive control for restriction enzyme accessibility nucleosome remodeling assays using the EpiDyne Remodeling Assay Substrate, as a DpnII restriction enzyme site is present within the 601 sequence.

DNA Sequence: GAATTCATCAGAATCCCGGTGCCGAGGCCGATCAATTGGTCGTAGACAGCTCTAGCACCGCTTAA
ACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCAC
GTGTCAGATATATACATCGATGATGATGGATAGATGGATGATGGATGGATGGATGATGATGGATG
AATAGATGGATGGATGAAGCTT

References:
Lowary PT and J Widom (1998). J Mol Biol 276: 19-42. Link

View technical datasheet for this product. 18-4101 Datasheet

18-4101 Gel Data

DNA Gel Data: EpiDyne Remodeling Assay Substrate DNA ST601-GATC1 (200 ng) run on a 1.8% TBE agarose gel. Migration positions of DNA molecular weight markers are indicated.
(Click image to enlarge)