Mononucleosomes, Recombinant, 187x601 DNA, Biotinylated

$549.00
SKU: 16-2004
Pack Size: 50 μg
Mononucleosomes, Recombinant, 187x601 DNA, Biotinylated Description: Mononucleosomes assembled from recombinant histones expressed in E. coli (two each of histones H2A, H2B, H3 and H4; accession numbers: H2A-P06897; H2B-P02281; H3-Q92133; H4-P62799) wrapped by 187 base pairs of DNA containing the 601 positioning sequence DNA. The the 187bp DNA sequence contains a centrally positioned 601 sequence, identified by Lowary and Widom, is a 147-base pair sequence that has high affinity for histone octamers and is useful for nucleosome assembly. The 601 sequence is flanked by a 20 bp sequence as shown in application notes and contains a 5' biotin-TEG group.

Formulation: Mononucleosomes, Recombinant, 187x601 DNA (50 μg DNA+protein, 24.3 μg protein weight) in 46 μl 10 mM Tris pH 7.5, 25 mM NaCl, 1 mM EDTA, 2 mM EDTA, 20% glycerol. Molarity = 4.84 μmolar. MW = 224,566 D

Storage and Stability: Stable for six months at -80°C from date of receipt. For best results, aliquot and avoid multiple freeze/thaws.

Mononucleosomes, Recombinant, 187x601 DNA, Biotinylated
Application Notes:

5’Bio-TEGGGACCCTATACGCGGCCGCCCTGGAGAATCCCGGTCTGCAG
GCCGCTCAATTGGTCGTAGACAGCTCTACGTGGCGAATTTGC
GTGCATGCGCCTGTCCCCCGCGTTTTAACCGCCAAGGGGATT
ACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTG
CCGGTCGCGAACAGCGACC 3’

3’ CCTGGGATATGCGCCGGCGGGACCTCTTAGGGCCAGACGT
CCGGCGAGTTAACCAGCATCTGTCGAGATGCACCGCTTAAAC
GCACGTACGCGGACAGGGGGCGCAAAATTGGCGGTTCCCCT
AATGAGGGATCAGAGGTCCGTGCACAGTCTATATATGTAGG
ACACGGCCAGCGCTTGTCGCTGG 5’


References:


View technical datasheet for this product. 16-2003 Datasheet

16-2003 Protein Gel
Protein Gel Data: Coomassie stained PAGE gel of proteins in Mononucleosomes, Recombinant, 187x601 DNA (0.75 µg) to demonstrate the purity of the histones in the preparation. Sizes of molecular weight markers and positions of the core histones (H2A, H2B, H3 and H4) are indicated.
(Click image to enlarge)

16-2003 DNA Gel
DNA Gel Data: Mononucleosomes, Recombinant, 187x601 DNA run on a native PAGE gel and stained with ethidium bromide to visualize DNA. Lane 1: Free DNA. Lane 2: Intact nucleosomes (200 ng).
(Click image to enlarge)
Current stock: 0